Review



201192b eq four element calibration beads fluidigm  (fluidigm)


Bioz Verified Symbol fluidigm is a verified supplier
Bioz Manufacturer Symbol fluidigm manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    fluidigm 201192b eq four element calibration beads fluidigm
    201192b Eq Four Element Calibration Beads Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 216 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/201192b+eq+four+element+calibration+beads+fluidigm/Cell-ID+Intercalator-Ir/pm35709757-250-90-96
    Average 96 stars, based on 216 article reviews
    201192b eq four element calibration beads fluidigm - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Labeling:

    Article Title: Human Immune System Variation during 1 Year.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html .. REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html ..

    Mass Cytometry:

    Article Title: Human Immune System Variation during 1 Year.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html .. REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html ..

    Expressing:

    Article Title: Human Immune System Variation during 1 Year.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html .. REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html ..

    Software:

    Article Title: Human Immune System Variation during 1 Year.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html .. REAGENT or RESOURCE SOURCE IDENTIFIER Benzonase Sigma-Aldrich Cat# E1014 1X PBS Rockland Cat# MB-008 EDTA Rockland Cat# MB-014 Sodium Azide Sigma-Aldrich Cat# 71289 Bovine Serum Albumin Sigma-Aldrich Cat# A3059 Paraformaldehyde Polysciences Cat# 00380-1 Intercalator-Ir Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar X8 Multimetal labeling kit Fluidigm Cat# 201300 Metal isotopes as chloride salts Fluidigm N/A Dimethyl Sulfoxide Sigma-Aldrich Cat# D8418 Cell-ID Cisplatin Fluidigm Cat# 201064 Metal isotopes as chloride salts Trace Sciences International N/A Protein Stabilizer PBS Candor Bioscience GmbH Cat# 131125 Critical Commercial Assays Test tube with 35 mm nylon mesh Corning Cat# 352235 Cardiometabolic panel Olink AB N/A Cell Regulation panel Olink AB N/A Cardiovascular II panel (CVD II) Olink AB N/A Cardiovascular III panel (CVD III) Olink AB N/A Development panel Olink AB N/A Immune Response panel Olink AB N/A Immuno-Oncology panel Olink AB N/A Oncology II panel Olink AB N/A Inflammation panel Olink AB N/A Metabolism panel Olink AB N/A Neurology, and Organ Damage panel Olink AB N/A Deposited Data FCS files, Mass cytometry This paper Protein expression data This paper Software and Algorithms Mass Cytometry Normalizer (Finck et al., 2013) https://github.com/nolanlab/bead-normalization/releases CyTOF software (v. 6.0.626) - https://www.fluidigm.com/ robCompositions 2.0.5 (Templ et al., 2011) https://cran.r-project.org/web/packages/robCompositions/ index.html Kohonen 3.0.2 (Wehrens and Buydens, 2007) https://cran.r-project.org/web/packages/kohonen/index.html dmbvs (Wadsworth et al., 2017) https://github.com/duncanwadsworth/dmbvs Princurve 2.1.3. (Hastie and Stuetzle, 1989) https://cran.r-project.org/web/packages/princurve/index.html MASS 7.3-51.1 (Venables and Ripley, 2002) https://cran.r-project.org/web/packages/MASS/index.html Sva 3.18.0 N/A http://bioconductor.org/packages/release/bioc/html/sva.html ..

    Cell Culture:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Next-Generation Sequencing:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Purification:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Blocking Assay:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Suspension:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Recombinant:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Diff-Quik:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    Staining:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.

    other:

    Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.



    Similar Products

    201192b eq four element calibration beads fluidigm  (fluidigm)
    96
    fluidigm 201192b eq four element calibration beads fluidigm
    201192b Eq Four Element Calibration Beads Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/201192b+eq+four+element+calibration+beads+fluidigm/Cell-ID+Intercalator-Ir/pm35709757-250-90-96
    Average 96 stars, based on 1 article reviews
    201192b eq four element calibration beads fluidigm - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    201192b eq four element calibration beads fluidigm 201078 zombie aqua fixable viability kit biolegend 423102 open  (fluidigm)
    96
    fluidigm 201192b eq four element calibration beads fluidigm 201078 zombie aqua fixable viability kit biolegend 423102 open
    KEY RESOURCES TABLE
    201192b Eq Four Element Calibration Beads Fluidigm 201078 Zombie Aqua Fixable Viability Kit Biolegend 423102 Open, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/201192b+eq+four+element+calibration+beads+fluidigm/Cell-ID+Intercalator-Ir/pmc05984186-612-148-154
    Average 96 stars, based on 1 article reviews
    201192b eq four element calibration beads fluidigm 201078 zombie aqua fixable viability kit biolegend 423102 open - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    201192b eq four element calibration beads fluidigm 201078 zombie aqua fixable viability kit biolegend 423102 please  (fluidigm)
    96
    fluidigm 201192b eq four element calibration beads fluidigm 201078 zombie aqua fixable viability kit biolegend 423102 please
    KEY RESOURCES TABLE
    201192b Eq Four Element Calibration Beads Fluidigm 201078 Zombie Aqua Fixable Viability Kit Biolegend 423102 Please, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/201192b+eq+four+element+calibration+beads+fluidigm/Cell-ID+Intercalator-Ir/pm29706550-275-76-82
    Average 96 stars, based on 1 article reviews
    201192b eq four element calibration beads fluidigm 201078 zombie aqua fixable viability kit biolegend 423102 please - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell

    Article Title: SINGLE-CELL CHROMATIN MODIFICATION PROFILING REVEALS INCREASED EPIGENETIC VARIATIONS WITH AGING

    doi: 10.1016/j.cell.2018.03.079

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Biological Samples Buffy coat from whole blood (for bio rep 1 and 2) Stanford Blood Center https://bloodcenter.stanford.edu/research-labs/research-products-and-services/blood-products/ PBMCs from twin subjects Brodin et al. study (PMID: 25594173) DOI: http://dx.doi.org/10.1016/j.cell.2014.12.020 Chemicals, Peptides, and Recombinant Proteins Ficoll-Paque PLUS GE Healthcare 17-1440-02 RBC lysis buffer (10X) BioLegend 420301 DMSO Sigma D2650 TCEP ThermoFisher 77720 Sodium azide Sigma S2002 EDTA Fisher BP120-500 16% paraformaldehyde Electron Microscopy Sciences 15710 Methanol Fisher Scientific A454-4 PBS ThermoFisher 10010-072 Software and Algorithms FlowJo FlowJo, LLC https://www.flowjo.com/ Other SepMate-50 STEMCELL Technologies 85460 Human AB serum heat-inactivated Valley Biomedical HP1022HI Maxpar X8 multi-metal labeling kit Fluidigm 201300 Antibody stabilizer (PBS-based) Boca Scientific 131 000 RPMI 1640 media ThermoFisher 22400-105 Fetal bovine serum ATCC 30-2020 Bovine serum albumin Sigma A3059 Cisplatin ENZO Life Sciences ALX-400-040-M250 DNase/RNase-free distilled water ThermoFisher 10977-023 Cell-ID 20-Plex Pd Barcoding Fluidigm 201060 Human TruStain FcX for Fc receptor blocking BioLegend 422302 Cell-I Intercalator-Ir—500 μM Fluidigm 201192B EQ four element calibration beads Fluidigm 201078 Zombie aqua fixable viability kit BioLegend 423102 Open in a separate window KEY RESOURCES TABLE Contact for Reagent and Resource Sharing Further information and requests for resources and reagents should be directed to, and will be fulfilled, by the Lead Contact, Alex J. Kuo ( ude.drofnats@9220xela ).

    Techniques: Formulation, Recombinant, Red Blood Cell Lysis, Electron Microscopy, Software, Labeling, Blocking Assay